Stem-loop sequence hsa-mir-548ay

AccessionMI0022210 (change log)
Symbol HGNC:MIR548AY
DescriptionHomo sapiens miR-548ay stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ay
(170 sentences)

Stem-loop
        a  c     ac      g      a               u  -   ua 
5' agaag ug uuacu  uagguu gugcaa aguaauugugguuuu gc auu  a
   ||||| || |||||  |||||| |||||| ||||||||||||||| || |||   
3' ucuuc ac aaugg  auccaa cacguu ucauuagcgccaaaa cg uaa  a
        -  -     ca      g      c               c  g   ug 
Get sequence
Deep sequencing
12938 reads, 8.44 reads per million, 154 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 32506283-32506389 [-]
antisense
OTTHUMT00000342112 ; CMTM7-006; intron 3
ENST00000487007 ; CMTM7-006; intron 3
Database links

Mature sequence hsa-miR-548ay-5p

Accession MIMAT0025452
Sequence

28 - 

aaaaguaauugugguuuuugc

 - 48

Get sequence
Deep sequencing12156 reads, 154 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-548ay-3p

Accession MIMAT0025453
Sequence

64 - 

caaaaccgcgauuacucuugca

 - 85

Get sequence
Deep sequencing332 reads, 65 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).