Stem-loop sequence hsa-mir-548ax

AccessionMI0019286 (change log)
Symbol HGNC:MIR548AX
DescriptionHomo sapiens miR-548ax stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ax
(170 sentences)

Stem-loop
   ga                         -     gga 
5'   uuggugcagaaguaauugcgguuuu gccau   a
     ||||||||||||||||||||||||| |||||    
3'   aaccauguuuucauuaaugccaaaa cggua   a
   cc                         a     aug 
Get sequence
Deep sequencing
3600 reads, 1.45 reads per million, 138 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 11318614-11318686 [-]
sense
OTTHUMT00000055766 ; ARHGAP6-007; intron 1
OTTHUMT00000055760 ; ARHGAP6-001; intron 1
OTTHUMT00000055761 ; ARHGAP6-002; intron 1
OTTHUMT00000291400 ; ARHGAP6-008; intron 1
OTTHUMT00000055762 ; ARHGAP6-003; intron 1
ENST00000380736 ; ARHGAP6-007; intron 1
ENST00000337414 ; ARHGAP6-001; intron 1
ENST00000495242 ; ARHGAP6-002; intron 1
ENST00000489330 ; ARHGAP6-008; intron 1
ENST00000380718 ; ARHGAP6-003; intron 1
ENST00000380732 ; ARHGAP6-201; intron 1
ENST00000413512 ; ARHGAP6-202; intron 1
antisense
OTTHUMT00000055746 ; AMELX-001; intron 5
OTTHUMT00000055747 ; AMELX-002; intron 6
ENST00000348912 ; AMELX-201; intron 4
ENST00000380714 ; AMELX-001; intron 5
ENST00000380712 ; AMELX-002; intron 6
Database links

Mature sequence hsa-miR-548ax

Accession MIMAT0022474
Sequence

10 - 

agaaguaauugcgguuuugcca

 - 31

Get sequence
Deep sequencing1803 reads, 123 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).