Stem-loop sequence hsa-mir-548au

AccessionMI0019145 (change log)
Symbol HGNC:MIR548AU
DescriptionHomo sapiens miR-548au stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548au
(170 sentences)

Stem-loop
   -------            g   uuu  u 
5'        aaaaguaauugc guu   gc a
          |||||||||||| |||   || u
3'        uuuucauugacg uaa   ug u
   gaccacg            g   uuu  g 
Get sequence
Deep sequencing
12260 reads, 8.61 reads per million, 151 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 93594841-93594894 [+]
sense
OTTHUMT00000053018 ; SYK-001; intron 1
OTTHUMT00000053021 ; SYK-004; intron 1
OTTHUMT00000053020 ; SYK-003; intron 1
OTTHUMT00000053022 ; SYK-005; intron 1
OTTHUMT00000053019 ; SYK-002; intron 1
ENST00000375754 ; SYK-001; intron 1
ENST00000375751 ; SYK-004; intron 1
ENST00000375747 ; SYK-003; intron 1
ENST00000476708 ; SYK-005; intron 1
ENST00000375746 ; SYK-002; intron 1
Database links

Mature sequence hsa-miR-548au-5p

Accession MIMAT0022291
Sequence

1 - 

aaaaguaauugcgguuuuugc

 - 21

Get sequence
Deep sequencing12208 reads, 151 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-548au-3p

Accession MIMAT0022292
Sequence

34 - 

uggcaguuacuuuugcaccag

 - 54

Get sequence
Deep sequencing52 reads, 14 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).