Stem-loop sequence hsa-mir-548at

AccessionMI0019137 (change log)
Symbol HGNC:MIR548AT
DescriptionHomo sapiens miR-548at stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548at
(170 sentences)

Stem-loop
   --                      gccaa 
5'   aaaaguuauugcgguuuuggcu     a
     ||||||||||||||||||||||      
3'   uuuucaaugacgccaaaaccgg     a
   ug                      uaaag 
Get sequence
Deep sequencing
2637 reads, 0.862 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 42494773-42494830 [+]
antisense
OTTHUMT00000457796 ; GPATCH8-003; intron 5
OTTHUMT00000457799 ; GPATCH8-010; intron 5
OTTHUMT00000457797 ; GPATCH8-001; intron 6
OTTHUMT00000457798 ; GPATCH8-002; intron 7
OTTHUMT00000457800 ; GPATCH8-006; intron 8
ENST00000335500 ; GPATCH8-003; intron 5
ENST00000585614 ; GPATCH8-010; intron 5
ENST00000591680 ; GPATCH8-001; intron 6
ENST00000587228 ; GPATCH8-002; intron 7
ENST00000434000 ; GPATCH8-201; intron 7
ENST00000590041 ; GPATCH8-006; intron 8
Database links

Mature sequence hsa-miR-548at-5p

Accession MIMAT0022277
Sequence

1 - 

aaaaguuauugcgguuuuggcu

 - 22

Get sequence
Deep sequencing2380 reads, 120 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-548at-3p

Accession MIMAT0022278
Sequence

38 - 

caaaaccgcaguaacuuuugu

 - 58

Get sequence
Deep sequencing256 reads, 43 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
2
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).