Stem-loop sequence hsa-mir-548as

AccessionMI0019132 (change log)
Symbol HGNC:MIR548AS
DescriptionHomo sapiens miR-548as stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548as
(170 sentences)

Stem-loop
   --aaaa       c              c 
5'       guaauug ggguuuugccguug u
         ||||||| ||||||||||||||  
3'       uauuaac cccaaaaugguaau u
   uguuug       a              u 
Get sequence
Deep sequencing
4672 reads, 1.69 reads per million, 118 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 92490163-92490220 [+]
sense
OTTHUMT00000045454 ; GPC5-001; intron 5
ENST00000377067 ; GPC5-001; intron 5
Database links

Mature sequence hsa-miR-548as-5p

Accession MIMAT0022267
Sequence

1 - 

aaaaguaauugcggguuuugcc

 - 22

Get sequence
Deep sequencing4646 reads, 118 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-548as-3p

Accession MIMAT0022268
Sequence

37 - 

uaaaacccacaauuauguuugu

 - 58

Get sequence
Deep sequencing25 reads, 11 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).