Stem-loop sequence hsa-mir-548ar

AccessionMI0019131 (change log)
Symbol HGNC:MIR548AR
DescriptionHomo sapiens miR-548ar stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ar
(170 sentences)

Stem-loop
   --                  u  ug   a 
5'   aaaaguaauugcaguuuu gc  uug a
     |||||||||||||||||| ||  |||  
3'   uuuuuauugacgucaaaa ug  gau c
   cg                  -  gu   g 
Get sequence
Deep sequencing
3747 reads, 0.775 reads per million, 129 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 114244505-114244561 [+]
sense
OTTHUMT00000045918 ; TFDP1-001; intron 2
OTTHUMT00000045920 ; TFDP1-003; intron 2
OTTHUMT00000045922 ; TFDP1-005; intron 2
OTTHUMT00000045923 ; TFDP1-006; intron 2
OTTHUMT00000045919 ; TFDP1-002; intron 3
ENST00000375370 ; TFDP1-001; intron 2
ENST00000465174 ; TFDP1-003; intron 2
ENST00000408980 ; TFDP1-005; intron 2
ENST00000453989 ; TFDP1-006; intron 2
ENST00000538138 ; TFDP1-201; intron 2
ENST00000544902 ; TFDP1-202; intron 2
ENST00000475254 ; TFDP1-002; intron 3
Database links

Mature sequence hsa-miR-548ar-5p

Accession MIMAT0022265
Sequence

1 - 

aaaaguaauugcaguuuuugc

 - 21

Get sequence
Deep sequencing3306 reads, 127 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-548ar-3p

Accession MIMAT0022266
Sequence

37 - 

uaaaacugcaguuauuuuugc

 - 57

Get sequence
Deep sequencing439 reads, 43 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).