Stem-loop sequence hsa-mir-548aq

AccessionMI0019130 (change log)
Symbol HGNC:MIR548AQ
DescriptionHomo sapiens miR-548aq stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548aq
(170 sentences)

Stem-loop
   --            u            ac 
5'   gaaaguaauugc guuuuugccauu  u
     |||||||||||| ||||||||||||   
3'   uuuucauuaacg caaaaacgguga  u
   cg            u            cu 
Get sequence
Deep sequencing
5357 reads, 3.42 reads per million, 117 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 185767847-185767904 [-]
sense
OTTHUMT00000344957 ; ETV5-011; intron 3
OTTHUMT00000344958 ; ETV5-012; intron 4
OTTHUMT00000344947 ; ETV5-001; intron 12
OTTHUMT00000344948 ; ETV5-002; intron 12
ENST00000433149 ; ETV5-011; intron 3
ENST00000480706 ; ETV5-012; intron 4
ENST00000306376 ; ETV5-001; intron 12
ENST00000434744 ; ETV5-002; intron 12
ENST00000537818 ; ETV5-201; intron 12
Database links

Mature sequence hsa-miR-548aq-5p

Accession MIMAT0022263
Sequence

1 - 

gaaaguaauugcuguuuuugcc

 - 22

Get sequence
Deep sequencing1059 reads, 91 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-548aq-3p

Accession MIMAT0022264
Sequence

37 - 

caaaaacugcaauuacuuuugc

 - 58

Get sequence
Deep sequencing4295 reads, 106 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).