Stem-loop sequence hsa-mir-548an

AccessionMI0016907 (change log)
Symbol HGNC:MIR548AN
DescriptionHomo sapiens miR-548an stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548an
(170 sentences)

Stem-loop
   c                   c               uauaa 
5'  auuagguuggugcaaaagg auugugguuuuugcc     a
    ||||||||||||||||||| |||||||||||||||      
3'  uaauccaaccacguuuucc uaacgccaaaaacgg     a
   -                   u               uaaug 
Get sequence
Deep sequencing
1771 reads, 0 reads per million, 106 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 106639814-106639896 [+]
intergenic
Database links

Mature sequence hsa-miR-548an

Accession MIMAT0019079
Sequence

15 - 

aaaaggcauugugguuuuug

 - 34

Get sequence
Deep sequencing750 reads, 58 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).