Stem-loop sequence hsa-mir-548am

AccessionMI0016904 (change log)
Symbol HGNC:MIR548AM
DescriptionHomo sapiens miR-548am stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548am
(170 sentences)

Stem-loop
   a                                cga 
5'  guuggugcaaaaguaauugcgguuuuugccgu   a
    ||||||||||||||||||||||||||||||||    
3'  uaaccauguuuucauugacgucaaaaacggua   a
   g                                aua 
Get sequence
Deep sequencing
18321 reads, 17 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 16627012-16627085 [-]
sense
OTTHUMT00000055907 ; CTPS2-002; intron 17
OTTHUMT00000055906 ; CTPS2-001; intron 17
ENST00000359276 ; CTPS2-002; intron 17
ENST00000380241 ; CTPS2-001; intron 17
ENST00000443824 ; CTPS2-201; intron 17
Database links

Mature sequence hsa-miR-548am-5p

Accession MIMAT0022740
Sequence

10 - 

aaaaguaauugcgguuuuugcc

 - 31

Get sequence
Deep sequencing14554 reads, 152 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-548am-3p

Accession MIMAT0019076
Previous IDshsa-miR-548am
Sequence

46 - 

caaaaacugcaguuacuuuugu

 - 67

Get sequence
Deep sequencing3751 reads, 124 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).