Stem-loop sequence hsa-mir-548ak

AccessionMI0016840 (change log)
Symbol HGNC:MIR548AK
DescriptionHomo sapiens miR-548ak stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ak
(170 sentences)

Stem-loop
   g           c         ug ga 
5'  ugcaaaaguaa ugcgguuuu  a  a
    ||||||||||| |||||||||  |  g
3'  acguuuucauu acgccaaaa  u  u
   g           a         gu aa 
Get sequence
Deep sequencing
6063 reads, 3.05 reads per million, 131 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 12130760-12130816 [-]
antisense
OTTHUMT00000046778 ; DHTKD1-002; intron 2
OTTHUMT00000046782 ; DHTKD1-006; intron 3
OTTHUMT00000046777 ; DHTKD1-001; intron 4
ENST00000465617 ; DHTKD1-002; intron 2
ENST00000437298 ; DHTKD1-006; intron 3
ENST00000263035 ; DHTKD1-001; intron 4
Database links

Mature sequence hsa-miR-548ak

Accession MIMAT0019013
Sequence

5 - 

aaaaguaacugcgguuuuuga

 - 25

Get sequence
Deep sequencing3796 reads, 128 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).