Stem-loop sequence hsa-mir-548aj-2

AccessionMI0016815 (change log)
Symbol HGNC:MIR548AJ2
DescriptionHomo sapiens miR-548aj-2 stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548aj-2
(170 sentences)

Stem-loop
   a                c                          c 
5'  agguauuagguuggug aaaaguaauugcaguuuuugcuauua u
    |||||||||||||||| ||||||||||||||||||||||||||  
3'  uuuauaauccaaccac uuuucauuaacgucaaaaaugguaau u
   a                a                          u 
Get sequence
Deep sequencing
7418 reads, 2.7 reads per million, 148 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 38023895-38023986 [-]
sense
OTTHUMT00000056243 ; SRPX-003; intron 5
ENST00000343800 ; SRPX-201; intron 4
ENST00000544439 ; SRPX-204; intron 4
ENST00000432886 ; SRPX-202; intron 4
ENST00000378533 ; SRPX-003; intron 5
ENST00000538295 ; SRPX-203; intron 5
antisense
OTTHUMT00000363378 ; RP5-972B16.2-001; intron 3
ENST00000465127 ; TM4SF2-001; intron 3
Database links

Mature sequence hsa-miR-548aj-5p

Accession MIMAT0022739
Sequence

16 - 

ugcaaaaguaauugcaguuuuug

 - 38

Get sequence
Deep sequencing4984 reads, 149 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-548aj-3p

Accession MIMAT0018990
Previous IDshsa-miR-548aj
Sequence

55 - 

uaaaaacugcaauuacuuuua

 - 75

Get sequence
Deep sequencing4677 reads, 100 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).