Stem-loop sequence hsa-mir-548aj-1

AccessionMI0016814 (change log)
Symbol HGNC:MIR548AJ1
DescriptionHomo sapiens miR-548aj-1 stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548aj-1
(170 sentences)

Stem-loop
   a                     g  a        a 
5'  uugguguaaaaguaauugcag uu ugccauua a
    ||||||||||||||||||||| || ||||||||  
3'  aaucacauuuucauuaacguc aa augguaau a
   c                     a  a        g 
Get sequence
Deep sequencing
2680 reads, 2 reads per million, 100 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 132115192-132115263 [-]
intergenic
Database links

Mature sequence hsa-miR-548aj-3p

Accession MIMAT0018990
Previous IDshsa-miR-548aj
Sequence

45 - 

uaaaaacugcaauuacuuuua

 - 65

Get sequence
Deep sequencing4677 reads, 100 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).