Stem-loop sequence hsa-mir-548ai

AccessionMI0016813 (change log)
Symbol HGNC:MIR548AI
DescriptionHomo sapiens miR-548ai stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ai
(170 sentences)

Stem-loop
   g                         ca      ---c    uu 
5'  uauuagguuggugcaaagguaauug  guuuuu    ccau  a
    |||||||||||||||||||||||||  ||||||    ||||  a
3'  auaauccaacuacguuuucauuaac  uaaaaa    ggua  a
   a                         ac      aaaa    ua 
Get sequence
Deep sequencing
3790 reads, 0.787 reads per million, 127 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 99124609-99124696 [+]
intergenic
Database links

Mature sequence hsa-miR-548ai

Accession MIMAT0018989
Sequence

16 - 

aaagguaauugcaguuuuuccc

 - 37

Get sequence
Deep sequencing1247 reads, 109 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).