Stem-loop sequence hsa-mir-548ah

AccessionMI0016796 (change log)
Symbol HGNC:MIR548AH
DescriptionHomo sapiens miR-548ah stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ah
(170 sentences)

Stem-loop
   a                        g    c  a  a 
5'  gguuggugcaaaagugauugcagu uuug ca ua a
    |||||||||||||||||||||||| |||| || ||  
3'  ccgaccacguuuucauugacguca aaac gu au a
   c                        a    a  a  g 
Get sequence
Deep sequencing
3531 reads, 7.87 reads per million, 127 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 76575551-76575626 [+]
antisense
OTTHUMT00000252401 ; G3BP2-003; intron 7
OTTHUMT00000252400 ; G3BP2-002; intron 8
OTTHUMT00000252399 ; G3BP2-001; intron 8
ENST00000357854 ; G3BP2-003; intron 7
ENST00000395719 ; G3BP2-002; intron 8
ENST00000359707 ; G3BP2-001; intron 8
Clustered miRNAs
< 10kb from hsa-mir-548ah
hsa-mir-4450chr4: 76573568-76573632 [+]
hsa-mir-548ahchr4: 76575551-76575626 [+]
Database links

Mature sequence hsa-miR-548ah-5p

Accession MIMAT0018972
Previous IDshsa-miR-548ah
Sequence

11 - 

aaaagugauugcaguguuug

 - 30

Get sequence
Deep sequencing126 reads, 55 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-548ah-3p

Accession MIMAT0020957
Sequence

47 - 

caaaaacugcaguuacuuuugc

 - 68

Get sequence
Deep sequencing3376 reads, 120 experiments
Evidence not experimental
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
3
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).