Stem-loop sequence hsa-mir-548ag-1

AccessionMI0016793 (change log)
Symbol HGNC:MIR548AG1
DescriptionHomo sapiens miR-548ag-1 stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ag-1
(170 sentences)

Stem-loop
   --            u      uuc    u   a 
5'   gugcaaagguaa uguggu   ugcu uua a
     |||||||||||| ||||||   |||| |||  
3'   cacguuuucauu acauua   acgg aau g
   ac            u      uaa    u   g 
Get sequence
Deep sequencing
2663 reads, 3.73 reads per million, 134 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 60922619-60922684 [+]
intergenic
Database links

Mature sequence hsa-miR-548ag

Accession MIMAT0018969
Sequence

5 - 

aaagguaauugugguuucugc

 - 25

Get sequence
Deep sequencing5369 reads, 144 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).