Stem-loop sequence hsa-mir-548ae-1

AccessionMI0016779 (change log)
Symbol HGNC:MIR548AE1
DescriptionHomo sapiens miR-548ae-1 stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ae-1
(170 sentences)

Stem-loop
       uuuuugccauua                  u 
5' gcag            aguugcgguuuuugccau a
   ||||            ||||||||||||||||||  
3' cguc            uuaacgucaaaaacggua u
       --cacacuuuca                  a 
Get sequence
Deep sequencing
3964 reads, 15.8 reads per million, 101 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 184378975-184379044 [+]
intergenic
Database links

Mature sequence hsa-miR-548ae-3p

Accession MIMAT0018954
Previous IDshsa-miR-548ae
Sequence

43 - 

caaaaacugcaauuacuuuca

 - 63

Get sequence
Deep sequencing7942 reads, 103 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).