Stem-loop sequence hsa-mir-548ad

AccessionMI0016770 (change log)
Symbol HGNC:MIR548AD
DescriptionHomo sapiens miR-548ad stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ad
(170 sentences)

Stem-loop
   c                    a     g       -a     
5'  uguuagguuggugcaaaagu auugu guuuuug  aagu 
    |||||||||||||||||||| ||||| |||||||  ||| a
3'  auaaucuaaccacguuuuca uaaca caaaagc  uuca 
   c                    g     g       gg     
Get sequence
Deep sequencing
11371 reads, 8.44 reads per million, 154 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 35471405-35471486 [+]
intergenic
Database links

Mature sequence hsa-miR-548ad-5p

Accession MIMAT0032114
Sequence

16 - 

aaaaguaauugugguuuuug

 - 35

Get sequence
Deep sequencing10791 reads, 154 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-548ad-3p

Accession MIMAT0018946
Previous IDshsa-miR-548ad
Sequence

49 - 

gaaaacgacaaugacuuuugca

 - 70

Get sequence
Deep sequencing131 reads, 42 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).