Stem-loop sequence hsa-mir-548ab

AccessionMI0016752 (change log)
Symbol HGNC:MIR548AB
DescriptionHomo sapiens miR-548ab stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ab
(170 sentences)

Stem-loop
   au            g         a      u     uu  a 
5'   guuggugcaaaa uaauugugg uuuugc auuac  gu u
     |||||||||||| ||||||||| |||||| |||||  ||  
3'   caaccacguuuu auuaacgcc aaaacg uaaug  ua u
   -c            g         c      -     uu  u 
Get sequence
Deep sequencing
6873 reads, 7.19 reads per million, 153 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 103524033-103524116 [-]
intergenic
Database links

Mature sequence hsa-miR-548ab

Accession MIMAT0018928
Sequence

11 - 

aaaaguaauuguggauuuugcu

 - 32

Get sequence
Deep sequencing6632 reads, 152 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).