Stem-loop sequence hsa-mir-548aa-1

AccessionMI0016689 (change log)
Symbol HGNC:MIR548AA1
DescriptionHomo sapiens miR-548aa-1 stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548aa-1
(170 sentences)

Stem-loop
   -------cuu      uc           a  c             auuac 
5'           uauuag  uggugcaaaag aa ugugguuuuugcc     u
             ||||||  ||||||||||| || |||||||||||||      
3'           auaauc  accacguuuuc uu acaccaaaaacgg     u
   uuuguucaau      ca           a  a             acauu 
Get sequence
Deep sequencing
4145 reads, 1.44 reads per million, 139 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 123348034-123348130 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-548aa-1
hsa-mir-548aa-1chr8: 123348034-123348130 [+]
hsa-mir-548d-1chr8: 123348034-123348130 [-]
Database links

Mature sequence hsa-miR-548aa

Accession MIMAT0018447
Sequence

55 - 

aaaaaccacaauuacuuuugcacca

 - 79

Get sequence
Deep sequencing8078 reads, 140 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1