Stem-loop sequence hsa-mir-544b

AccessionMI0014159 (change log)
Symbol HGNC:MIR544B
DescriptionHomo sapiens miR-544b stem-loop
Gene family MIPF0000436; mir-544
Literature search

13 open access papers mention hsa-mir-544b
(30 sentences)

Stem-loop
     a         -       g    -  uu    uag u 
5' gg auuuuguua aaaugca aauc ca  ucug   c c
   || ||||||||| ||||||| |||| ||  ||||   | u
3' cc ugaaacaau uuuacgu uugg gu  agau   g g
     g         c       g    a  cc    -ca a 
Get sequence
Deep sequencing
269 reads, 1.92 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 124732439-124732516 [+]
antisense
OTTHUMT00000355778 ; HEG1-003; exon 3
OTTHUMT00000355732 ; HEG1-001; exon 6
ENST00000477536 ; HEG1-003; exon 3
ENST00000311127 ; HEG1-001; exon 6
Database links

Mature sequence hsa-miR-544b

Accession MIMAT0015004
Sequence

48 - 

accugagguugugcauuucuaa

 - 69

Get sequence
Deep sequencing99 reads, 22 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).