Stem-loop sequence hsa-mir-520h

AccessionMI0003175 (change log)
Symbol HGNC:MIR520H
DescriptionHomo sapiens miR-520h stem-loop
Gene family MIPF0000020; mir-515
Literature search

44 open access papers mention hsa-mir-520h
(94 sentences)

Stem-loop
        u  u     cc        -        uc     guugu 
5' uccca gc gugac  ucuagagg aagcacuu  uguuu     c
   ||||| || |||||  |||||||| ||||||||  |||||     u
3' agggu ug cauug  agauuucc uucgugaa  acaaa     g
        u  u     --        c        --     aaaga 
Get sequence
Deep sequencing
1583 reads, 18.6 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53742512-53742599 [+]
antisense
OTTHUMT00000464278 ; ZNF677-010; exon 1
OTTHUMT00000464189 ; ZNF677-001; intron 4
OTTHUMT00000464190 ; ZNF677-004; intron 4
ENST00000599328 ; ZNF677-010; exon 1
ENST00000598513 ; ZNF677-001; intron 4
ENST00000594517 ; ZNF677-004; intron 4
ENST00000333952 ; ZNF677-201; intron 4
Clustered miRNAs
< 10kb from hsa-mir-520h
hsa-mir-518dchr19: 53734877-53734963 [+]
hsa-mir-516b-1chr19: 53736845-53736934 [+]
hsa-mir-518a-2chr19: 53739333-53739419 [+]
hsa-mir-517cchr19: 53741313-53741407 [+]
hsa-mir-520hchr19: 53742512-53742599 [+]
hsa-mir-521-1chr19: 53748636-53748722 [+]
hsa-mir-522chr19: 53751211-53751297 [+]
hsa-mir-519a-1chr19: 53752397-53752481 [+]
Database links

Mature sequence hsa-miR-520h

Accession MIMAT0002867
Sequence

55 - 

acaaagugcuucccuuuagagu

 - 76

Get sequence
Deep sequencing1558 reads, 62 experiments
Evidence experimental; array-cloned [1]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).