Stem-loop sequence hsa-mir-5197

AccessionMI0018176 (change log)
Symbol HGNC:MIR5197
DescriptionHomo sapiens miR-5197 stem-loop
Stem-loop
   -      auuccaca    --au      - a     a  aa   a          uu 
5'  uauggg        gaca    gaguau c auggc ca  cuc uucuugaauu  u
    ||||||        ||||    |||||| | ||||| ||  ||| ||||||||||   
3'  guacuc        cugu    cucgua g uacug gu  gag aagaacuuga  g
   u      -cacuuca    aaau      a c     a  ca   -          cc 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 143679860-143679971 [+]
sense
OTTHUMT00000371898 ; KCTD16-002; intron 2
OTTHUMT00000371897 ; KCTD16-001; intron 3
ENST00000507359 ; KCTD16-002; intron 2
ENST00000512467 ; KCTD16-001; intron 3
Database links

Mature sequence hsa-miR-5197-5p

Accession MIMAT0021130
Sequence

27 - 

caauggcacaaacucauucuuga

 - 49

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-5197-3p

Accession MIMAT0021131
Sequence

64 - 

aagaagagacugagucaucgaau

 - 86

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).