Stem-loop sequence hsa-mir-5196

AccessionMI0018175 (change log)
Symbol HGNC:MIR5196
DescriptionHomo sapiens miR-5196 stem-loop
Stem-loop
   u  ga     ccu     -g  aga    a    a            ug  ---g   a 
5'  cu  ggaga   gggcu  uc   ggcc ggga ggggacgagggu  gg    aac g
    ||  |||||   |||||  ||   |||| |||| ||||||||||||  ||    ||| g
3'  ga  ucucu   cccgg  ag   uugg cccu ccucugcuccua  uc    uug u
   g  ag     ccc     ga  --a    a    c            cu  acga   g 
Get sequence
Deep sequencing
324 reads, 20 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 35345513-35345627 [+]
sense
OTTHUMT00000464427 ; CTC-523E23.5-001; exon 5
ENST00000601776 ; CTC-523E23.5-001; exon 5
antisense
OTTHUMT00000469661 ; CTC-523E23.11-001; intron 1
OTTHUMT00000469662 ; CTC-523E23.11-002; intron 1
ENST00000603718 ; CTC-523E23.11-001; intron 1
ENST00000604749 ; CTC-523E23.11-002; intron 1
Database links

Mature sequence hsa-miR-5196-5p

Accession MIMAT0021128
Sequence

29 - 

agggaaggggacgaggguuggg

 - 50

Get sequence
Deep sequencing37 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-5196-3p

Accession MIMAT0021129
Sequence

69 - 

ucauccucgucucccucccag

 - 89

Get sequence
Deep sequencing262 reads, 43 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).