Stem-loop sequence hsa-mir-5195

AccessionMI0018174 (change log)
Symbol HGNC:MIR5195
DescriptionHomo sapiens miR-5195 stem-loop
Stem-loop
   -     aaa   --ag      a  ug     guuccuaa     a   c           aga 
5'  gagca   acc    agaaca ca  ggagc        ccccu agg aacuggauggg   c
    |||||   |||    |||||| ||  |||||        ||||| ||| |||||||||||    
3'  cuugu   ugg    ucuugu gu  ucucg        gggga ucu uugaccuaccc   c
   a     ---   aaca      -  gu     --------     g   c           agu 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 106850885-106850999 [-]
intergenic
Database links

Mature sequence hsa-miR-5195-5p

Accession MIMAT0021126
Sequence

36 - 

aaccccuaaggcaacuggaugg

 - 57

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-5195-3p

Accession MIMAT0021127
Sequence

70 - 

auccaguucucugagggggcu

 - 90

Get sequence
Deep sequencing9 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).