Stem-loop sequence hsa-mir-5194

AccessionMI0018173 (change log)
Symbol HGNC:MIR5194
DescriptionHomo sapiens miR-5194 stem-loop
Stem-loop
   au   uu   -   aacuuaa    ag    u   gg        --u   a        uugg 
5'   uuc  ugg guu       acuc  cccu cua  cccauucu   uuc cucaggaa    a
     |||  ||| |||       ||||  |||| |||  ||||||||   ||| ||||||||    u
3'   aag  acc cag       ugag  ggga ggu  ggguaagg   ggg gagucuuu    a
   --   -u   a   --accac    -a    c   -a        uuu   -        ucga 
Get sequence
Deep sequencing
66 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 130008334-130008453 [-]
intergenic
Database links

Mature sequence hsa-miR-5194

Accession MIMAT0021125
Sequence

73 - 

ugagggguuuggaaugggaugg

 - 94

Get sequence
Deep sequencing45 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).