Stem-loop sequence hsa-mir-5193

AccessionMI0018172 (change log)
Symbol HGNC:MIR5193
DescriptionHomo sapiens miR-5193 stem-loop
Stem-loop
   ---------ccuaggaaaggcugcu  u             guu        gua   a 
5'                          gg aacugggaugggg   ggggggag   aga g
                            || |||||||||||||   ||||||||   |||  
3'                          cc uugacccuacucc   uccuccuc   ucu u
   aggguucuccaggugaaguccacua  -             auc        -ag   c 
Get sequence
Deep sequencing
353 reads, 2.5 reads per million, 80 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 49806137-49806245 [-]
sense
OTTHUMT00000350380 ; IP6K1-001; intron 1
OTTHUMT00000350381 ; IP6K1-002; intron 1
OTTHUMT00000350382 ; IP6K1-003; intron 1
OTTHUMT00000350385 ; IP6K1-006; intron 1
ENST00000321599 ; IP6K1-001; intron 1
ENST00000468463 ; IP6K1-002; intron 1
ENST00000460540 ; IP6K1-003; intron 1
ENST00000498149 ; IP6K1-006; intron 1
ENST00000395238 ; IP6K1-201; intron 1
Database links

Mature sequence hsa-miR-5193

Accession MIMAT0021124
Sequence

60 - 

uccuccucuaccucaucccagu

 - 81

Get sequence
Deep sequencing164 reads, 64 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).