Stem-loop sequence hsa-mir-5192

AccessionMI0018171 (change log)
Symbol HGNC:MIR5192
DescriptionHomo sapiens miR-5192 stem-loop
Stem-loop
   uu   u    c u   g  u         -     u       gaagc 
5'   agu ccag c ccu gc caccuggaa ccauu cuccugg     a
     ||| |||| | ||| || ||||||||| ||||| |||||||      
3'   uca gguu g gga ug guggaccuu gguga gaggacc     u
   --   u    c -   g  -         a     -       gaugg 
Get sequence
Deep sequencing
21 reads, 4.76 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 62205826-62205917 [+]
sense
OTTHUMT00000327131 ; COMMD1-002; intron 1
OTTHUMT00000327136 ; COMMD1-007; intron 1
OTTHUMT00000251607 ; COMMD1-001; intron 1
OTTHUMT00000327133 ; COMMD1-004; intron 2
OTTHUMT00000327132 ; COMMD1-003; intron 3
ENST00000472729 ; COMMD1-002; intron 1
ENST00000471704 ; COMMD1-007; intron 1
ENST00000311832 ; COMMD1-001; intron 1
ENST00000538736 ; COMMD1-201; intron 1
ENST00000445644 ; COMMD1-004; intron 2
ENST00000455659 ; COMMD1-003; intron 3
Database links

Mature sequence hsa-miR-5192

Accession MIMAT0021123
Sequence

57 - 

aggagaguggauuccagguggu

 - 78

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).