Stem-loop sequence hsa-mir-5191

AccessionMI0018170 (change log)
Symbol HGNC:MIR5191
DescriptionHomo sapiens miR-5191 stem-loop
Stem-loop
               -    --a   c                 g          -cug    g 
5' aguuggccagga cccc   agc cccagcacuucauucuu cuguccucuc    gucu g
   |||||||||||| ||||   ||| ||||||||||||||||| ||||||||||    ||||  
3' ucaaccgguccu gggg   ucg gggucgugaaguaagaa gauaggagag    uagg g
               a    gau   c                 g          aaga    a 
Get sequence
Deep sequencing
71 reads, 64 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 201719508-201719627 [+]
sense
OTTHUMT00000087015 ; NAV1-003; intron 1
OTTHUMT00000087014 ; NAV1-002; intron 1
OTTHUMT00000087013 ; NAV1-001; intron 3
OTTHUMT00000087018 ; NAV1-006; intron 5
ENST00000490213 ; NAV1-003; intron 1
ENST00000367295 ; NAV1-002; intron 1
ENST00000367296 ; NAV1-001; intron 3
ENST00000295624 ; NAV1-201; intron 3
ENST00000367297 ; NAV1-202; intron 3
ENST00000367300 ; NAV1-203; intron 3
ENST00000367302 ; NAV1-006; intron 5
antisense
OTTHUMT00000087101 ; RP11-90L20.3-001; intron 2
ENST00000413035 ; IPO9-AS1-001; intron 2
Database links

Mature sequence hsa-miR-5191

Accession MIMAT0021122
Sequence

72 - 

aggauaggaagaaugaagugcu

 - 93

Get sequence
Deep sequencing53 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).