Stem-loop sequence hsa-mir-5190

AccessionMI0018169 (change log)
Symbol HGNC:MIR5190
DescriptionHomo sapiens miR-5190 stem-loop
Literature search

1 open access papers mention hsa-mir-5190
(1 sentences)

Stem-loop
   --   -caua             c u     a     aaug 
5'   ggu     cccuggcuccagc c gucac ugguu    u
     |||     ||||||||||||| | ||||| |||||     
3'   ccg     gggaccgaggucg g cagug accga    u
   cc   ucacc             a u     -     cacc 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 13459947-13460026 [+]
sense
OTTHUMT00000458326 ; LDLRAD4-002; intron 3
OTTHUMT00000458323 ; LDLRAD4-010; intron 4
OTTHUMT00000458325 ; LDLRAD4-001; intron 4
ENST00000581537 ; MIR5190-201; exon 1
ENST00000359446 ; LDLRAD4-002; intron 3
ENST00000587905 ; LDLRAD4-010; intron 4
ENST00000399848 ; LDLRAD4-001; intron 4
ENST00000361205 ; LDLRAD4-201; intron 4
Database links

Mature sequence hsa-miR-5190

Accession MIMAT0021121
Sequence

47 - 

ccagugacugagcuggagcca

 - 67

Get sequence
Deep sequencing31 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).