Stem-loop sequence hsa-mir-518c

AccessionMI0003159 (change log)
Symbol HGNC:MIR518C
DescriptionHomo sapiens miR-518c stem-loop
Gene family MIPF0000020; mir-515
Literature search

16 open access papers mention hsa-mir-518c
(20 sentences)

Stem-loop
   gcgagaaga     u        u              a   uc    g  u 
5'          ucuca gcugugac cucuggagggaagc cuu  uguu uc g
            ||||| |||||||| |||||||||||||| |||  |||| || a
3'          agagu uggcauug gagauuucucuucg gaa  acaa ag a
   ----cgaaa     u        u              c   --    a  a 
Get sequence
Deep sequencing
287 reads, 5.8 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53708735-53708835 [+]
sense
OTTHUMT00000464185 ; CTD-2245F17.3-001; intron 4
ENST00000597550 ; CTD-2245F17.3-001; intron 4
Clustered miRNAs
< 10kb from hsa-mir-518c
hsa-mir-518fchr19: 53700015-53700101 [+]
hsa-mir-520bchr19: 53701227-53701287 [+]
hsa-mir-518bchr19: 53702737-53702819 [+]
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
hsa-mir-518cchr19: 53708735-53708835 [+]
hsa-mir-524chr19: 53711002-53711088 [+]
hsa-mir-517achr19: 53712268-53712354 [+]
hsa-mir-519dchr19: 53713347-53713434 [+]
hsa-mir-521-2chr19: 53716594-53716680 [+]
Database links

Mature sequence hsa-miR-518c-5p

Accession MIMAT0002847
Previous IDshsa-miR-518c*
Sequence

24 - 

ucucuggagggaagcacuuucug

 - 46

Get sequence
Deep sequencing68 reads, 36 experiments
Evidence experimental; array-cloned [1]
Predicted targets

Mature sequence hsa-miR-518c-3p

Accession MIMAT0002848
Previous IDshsa-miR-518c
Sequence

62 - 

caaagcgcuucucuuuagagugu

 - 84

Get sequence
Deep sequencing87 reads, 37 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).