Stem-loop sequence hsa-mir-5189

AccessionMI0018168 (change log)
Symbol HGNC:MIR5189
DescriptionHomo sapiens miR-5189 stem-loop
Stem-loop
   ---  c  g  uu  a      u  -cu        a a     a   a    - ugg    
5'    gg cc cc  uu ggggcc cg   gucugggc c ggcgg ugg cagg c   ccu 
      || || ||  || |||||| ||   |||||||| | ||||| ||| |||| |   || c
3'    cc gg gg  ga cuccgg gc   cagacccg g cugcc acc gucc g   ggu 
   gga  a  -  uu  -      u  acc        a a     a   -    a -ua    
Get sequence
Deep sequencing
92 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 88468918-88469031 [+]
intergenic
Database links

Mature sequence hsa-miR-5189-5p

Accession MIMAT0021120
Sequence

26 - 

ucugggcacaggcggauggacagg

 - 49

Get sequence
Deep sequencing79 reads, 28 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-5189-3p

Accession MIMAT0027088
Sequence

67 - 

ugccaaccgucagagcccaga

 - 87

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).
2
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).