Stem-loop sequence hsa-mir-5188

AccessionMI0018167 (change log)
Symbol HGNC:MIR5188
DescriptionHomo sapiens miR-5188 stem-loop
Stem-loop
   ----------gggaggcauggaaauu          c       a         uaagca 
5'                           ucucugguuu aaugggu cgauuauug      g
                             |||||||||| ||||||| |||||||||      g
3'                           agaggccaaa uuaccca gcuaauaac      a
   acccuaagauaaggacagaaaauuuu          u       g         uuaccu 
Get sequence
Deep sequencing
134 reads, 0 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 124915547-124915659 [+]
antisense
OTTHUMT00000318187 ; NCOR2-019; intron 5
OTTHUMT00000400399 ; NCOR2-024; intron 6
OTTHUMT00000318173 ; NCOR2-005; intron 8
OTTHUMT00000318170 ; NCOR2-002; intron 9
OTTHUMT00000318169 ; NCOR2-001; intron 9
OTTHUMT00000318172 ; NCOR2-004; intron 9
OTTHUMT00000318171 ; NCOR2-003; intron 10
ENST00000448008 ; NCOR2-019; intron 5
ENST00000542927 ; NCOR2-024; intron 6
ENST00000405201 ; NCOR2-005; intron 8
ENST00000404621 ; NCOR2-002; intron 9
ENST00000429285 ; NCOR2-001; intron 9
ENST00000420698 ; NCOR2-004; intron 9
ENST00000356219 ; NCOR2-201; intron 9
ENST00000397355 ; NCOR2-202; intron 9
ENST00000404121 ; NCOR2-203; intron 9
ENST00000458234 ; NCOR2-003; intron 10
Database links

Mature sequence hsa-miR-5188

Accession MIMAT0021119
Sequence

64 - 

aaucggacccauuuaaaccggag

 - 86

Get sequence
Deep sequencing95 reads, 47 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).