Stem-loop sequence hsa-mir-5187

AccessionMI0018166 (change log)
Symbol HGNC:MIR5187
DescriptionHomo sapiens miR-5187 stem-loop
Literature search

1 open access papers mention hsa-mir-5187
(1 sentences)

Stem-loop
   ga   agg u    u   -     ga       c    au 
5'   cua   g ggga gag ggauu  aguggag agga  g
     |||   | |||| ||| |||||  ||||||| ||||   
3'   ggu   c uccu uuc ccuaa  ucaccuc uuuu  c
   --   gga -    u   u     -g       -    cg 
Get sequence
Deep sequencing
1354 reads, 1 reads per million, 100 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 161227186-161227261 [+]
intergenic
Database links

Mature sequence hsa-miR-5187-5p

Accession MIMAT0021117
Sequence

10 - 

ugggaugagggauugaagugga

 - 31

Get sequence
Deep sequencing1257 reads, 84 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-5187-3p

Accession MIMAT0021118
Sequence

52 - 

acugaauccucuuuuccucag

 - 72

Get sequence
Deep sequencing90 reads, 44 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).