Stem-loop sequence hsa-mir-5186

AccessionMI0018165 (change log)
Symbol HGNC:MIR5186
DescriptionHomo sapiens miR-5186 stem-loop
Stem-loop
   -uc            a u                          c          -cu a 
5'    agccagcuuaug c ugacccucucaccugauuucuaccaa cuuuccucag   g u
      |||||||||||| | |||||||||||||||||||||||||| ||||||||||   |  
3'    ucggucgaauac g acugggagaguggacuaaagaugguu gagagggguc   c u
   caa            c u                          a          uuu u 
Get sequence
Deep sequencing
183 reads, 13.6 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 151565876-151565995 [-]
sense
OTTHUMT00000357889 ; RP11-454C18.2-002; intron 1
OTTHUMT00000357888 ; RP11-454C18.2-001; intron 2
ENST00000475855 ; RP11-454C18.2-002; intron 1
ENST00000483843 ; RP11-454C18.2-001; intron 2
Database links

Mature sequence hsa-miR-5186

Accession MIMAT0021116
Sequence

72 - 

agagauugguagaaaucaggu

 - 92

Get sequence
Deep sequencing12 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).