Stem-loop sequence hsa-mir-514b

AccessionMI0014251 (change log)
Symbol HGNC:MIR514B
DescriptionHomo sapiens miR-514b stem-loop
Gene family MIPF0000130; mir-506
Literature search

11 open access papers mention hsa-mir-514b
(18 sentences)

Stem-loop
         g      u    -     gagg         g a 
5' caugug uacucu cuca agagg    caaucaugu u a
   |||||| |||||| |||| |||||    ||||||||| |  
3' guacac augagg gagu ucucc    guuaguaua a u
         a      u    g     -aca         g u 
Get sequence
Deep sequencing
183614 reads, 574 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 147250151-147250230 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-514b
hsa-mir-509-3chrX: 147259652-147259726 [-]
hsa-mir-509-2chrX: 147258760-147258850 [-]
hsa-mir-514bchrX: 147250151-147250230 [-]
Database links

Mature sequence hsa-miR-514b-5p

Accession MIMAT0015087
Sequence

13 - 

uucucaagagggaggcaaucau

 - 34

Get sequence
Deep sequencing1917 reads, 49 experiments
Evidence experimental; Illumina [1-4]
Database links
Predicted targets

Mature sequence hsa-miR-514b-3p

Accession MIMAT0015088
Sequence

50 - 

auugacaccucugugagugga

 - 70

Get sequence
Deep sequencing181689 reads, 53 experiments
Evidence experimental; Illumina [1,3-4]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3
4
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).