Stem-loop sequence hsa-mir-513c

AccessionMI0006649 (change log)
Symbol HGNC:MIR513C
DescriptionHomo sapiens miR-513c stem-loop
Gene family MIPF0000130; mir-506
Literature search

25 open access papers mention hsa-mir-513c
(149 sentences)

Stem-loop
   -  -     g   c       ag      uc        gaa 
5'  gc guaca ugc uuucuca  gaggug  guuuaugu   c
    || ||||| ||| |||||||  ||||||  ||||||||    
3'  cg caugu aug gaagagu  uuccac  uaaauaua   u
   a  a     a   a       cu      uu        aaa 
Get sequence
Deep sequencing
4498 reads, 23.9 reads per million, 71 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 147189704-147189787 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-513c
hsa-mir-513bchrX: 147199044-147199127 [-]
hsa-mir-513cchrX: 147189704-147189787 [-]
Database links

Mature sequence hsa-miR-513c-5p

Accession MIMAT0005789
Previous IDshsa-miR-513c
Sequence

14 - 

uucucaaggaggugucguuuau

 - 35

Get sequence
Deep sequencing3070 reads, 59 experiments
Evidence by similarity; MI0003191
Database links
Predicted targets

Mature sequence hsa-miR-513c-3p

Accession MIMAT0022728
Sequence

49 - 

uaaauuucaccuuucugagaaga

 - 71

Get sequence
Deep sequencing1423 reads, 35 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).