Stem-loop sequence hsa-mir-5100

AccessionMI0019116 (change log)
Symbol HGNC:MIR5100
DescriptionHomo sapiens miR-5100 stem-loop
Literature search

4 open access papers mention hsa-mir-5100
(9 sentences)

Stem-loop
   ccaugagg       a  ---   ----a     ---        gga  g   cu      g   ga 
5'         agcuggc gu   ggg     uggcc   ugggggua   gc ugg  ucugga cua  c
           ||||||| ||   |||     |||||   ||||||||   || |||  |||||| |||  c
3'         ucgacug cg   ucc     accgg   aucuccgu   cg acc  agacuu ggu  a
   --------       a  ggu   aggac     uca        -gg  -   cu      g   ac 
Get sequence
Deep sequencing
46912 reads, 108 reads per million, 152 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 42997563-42997681 [+]
intergenic
Database links

Mature sequence hsa-miR-5100

Accession MIMAT0022259
Sequence

68 - 

uucagaucccagcggugccucu

 - 89

Get sequence
Deep sequencing46891 reads, 152 experiments
Evidence experimental; SOLiD [1]
Database links
Predicted targets

References

1
PMID:21895886 "Deep sequencing of short RNAs reveals novel microRNAs in minor salivary glands of patients with Sjogren's syndrome" Tandon M, Gallo A, Jang SI, Illei GG, Alevizos I Oral Dis. 18:127-131(2012).