Stem-loop sequence hsa-mir-5094

AccessionMI0017983 (change log)
Symbol HGNC:MIR5094
DescriptionHomo sapiens miR-5094 stem-loop
Stem-loop
   aaaa   aaaaa       au    --  a     a    cugc 
5'     gaa     ucaguga  gccu  ug accua caca    c
       |||     |||||||  ||||  || ||||| ||||     
3'     cuu     agucacu  cggg  ac uggau gugu    u
   ucaa   -acaa       --    ug  a     g    auuu 
Get sequence
Deep sequencing
92 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 89850637-89850721 [-]
antisense
OTTHUMT00000421149 ; FANCI-015; intron 2
OTTHUMT00000421153 ; FANCI-006; exon 19
OTTHUMT00000421152 ; FANCI-005; 3'UTR (exon 26)
OTTHUMT00000421145 ; FANCI-004; 3'UTR (exon 31)
OTTHUMT00000256568 ; FANCI-001; 3'UTR (exon 32)
OTTHUMT00000421140 ; FANCI-002; 3'UTR (exon 33)
ENST00000565522 ; FANCI-015; intron 2
ENST00000566895 ; FANCI-006; exon 19
ENST00000561894 ; FANCI-005; 3'UTR (exon 26)
ENST00000447611 ; FANCI-004; 3'UTR (exon 31)
ENST00000300027 ; FANCI-001; 3'UTR (exon 32)
ENST00000310775 ; FANCI-002; 3'UTR (exon 33)
Database links

Mature sequence hsa-miR-5094

Accession MIMAT0021086
Sequence

11 - 

aaucagugaaugccuugaaccu

 - 32

Get sequence
Deep sequencing75 reads, 23 experiments
Evidence experimental; Illumina [1], qPCR [1]
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).