Stem-loop sequence hsa-mir-5093

AccessionMI0017982 (change log)
Symbol HGNC:MIR5093
DescriptionHomo sapiens miR-5093 stem-loop
Stem-loop
   cccgccagguccacaugccagagugucaac   ac  -          -c       g  a 
5'                               gug  cc agccagccuc  uuccuga cu g
                                 |||  || ||||||||||  ||||||| ||  
3'                               cac  gg ucggucggag  aaggauu gg g
   ----------------------gggaccga   ga  a          ua       a  a 
Get sequence
Deep sequencing
23 reads, 38.5 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 85306226-85306325 [-]
intergenic
Database links

Mature sequence hsa-miR-5093

Accession MIMAT0021085
Sequence

68 - 

aggaaaugaggcuggcuaggagc

 - 90

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1], qPCR [1]
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).