Stem-loop sequence hsa-mir-5092

AccessionMI0017981 (change log)
Symbol HGNC:MIR5092
DescriptionHomo sapiens miR-5092 stem-loop
Stem-loop
   a                  a  -     g   c   acaacaug 
5'  ucccagaucagaugccaa gc cagug gga ugg        a
    |||||||||||||||||| || ||||| ||| |||        u
3'  aggguuuagucuacgguu cg gucgc ccu acc        g
   -                  -  a     a   a   aaacccga 
Get sequence
Deep sequencing
37 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 125151465-125151552 [-]
intergenic
Database links

Mature sequence hsa-miR-5092

Accession MIMAT0021084
Sequence

57 - 

aauccacgcugagcuuggcauc

 - 78

Get sequence
Deep sequencing30 reads, 13 experiments
Evidence experimental; Illumina [1], qPCR [1]
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).