Stem-loop sequence hsa-mir-5091

AccessionMI0017980 (change log)
Symbol HGNC:MIR5091
DescriptionHomo sapiens miR-5091 stem-loop
Stem-loop
   ga  g    -ga   a   ga  a   - g       c  ggguugu 
5'   cu uggc   cgg gac  ca gac u ugcuggu gc       g
     || ||||   ||| |||  || ||| | ||||||| ||        
3'   gg auug   guc cug  gu cug g acggcca ug       g
   uc  g    gag   c   ag  -   g g       c  gauuugg 
Get sequence
Deep sequencing
267 reads, 6.32 reads per million, 95 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 13627865-13627957 [+]
antisense
OTTHUMT00000207321 ; BOD1L1-001; intron 1
OTTHUMT00000351713 ; BOD1L1-002; 3'UTR (exon 2)
ENST00000040738 ; BOD1L1-001; intron 1
ENST00000482713 ; BOD1L1-002; 3'UTR (exon 2)
Database links

Mature sequence hsa-miR-5091

Accession MIMAT0021083
Sequence

11 - 

acggagacgacaagacugugcug

 - 33

Get sequence
Deep sequencing233 reads, 89 experiments
Evidence experimental; Illumina [1], qPCR [1]
Database links
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).