Stem-loop sequence hsa-mir-5090

AccessionMI0017979 (change log)
Symbol HGNC:MIR5090
DescriptionHomo sapiens miR-5090 stem-loop
Stem-loop
   -     --   ----accc        uu   g     u  aaag 
5'  ucuga  ggu        ggggcaga  ggu uaggg gc    c
    |||||  |||        ||||||||  ||| ||||| ||    c
3'  ggacu  ccg        ccccgucu  ccg auccc cg    u
   a     gu   accucaac        -u   a     c  cccg 
Get sequence
Deep sequencing
335 reads, 2.78 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 102465742-102465826 [+]
antisense
OTTHUMT00000348007 ; FBXL13-007; intron 11
OTTHUMT00000348003 ; FBXL13-003; intron 17
OTTHUMT00000348005 ; FBXL13-005; intron 17
OTTHUMT00000348002 ; FBXL13-002; intron 18
OTTHUMT00000348006 ; FBXL13-006; intron 18
OTTHUMT00000348001 ; FBXL13-001; intron 18
ENST00000456695 ; FBXL13-007; intron 11
ENST00000379306 ; FBXL13-201; intron 11
ENST00000379305 ; FBXL13-003; intron 17
ENST00000455112 ; FBXL13-005; intron 17
ENST00000393772 ; FBXL13-203; intron 17
ENST00000379308 ; FBXL13-202; intron 17
ENST00000448002 ; FBXL13-002; intron 18
ENST00000436908 ; FBXL13-006; intron 18
ENST00000313221 ; FBXL13-001; intron 18
Clustered miRNAs
< 10kb from hsa-mir-5090
hsa-mir-5090chr7: 102465742-102465826 [+]
hsa-mir-4467chr7: 102471469-102471531 [+]
Database links

Mature sequence hsa-miR-5090

Accession MIMAT0021082
Sequence

11 - 

ccggggcagauugguguagggug

 - 33

Get sequence
Deep sequencing323 reads, 68 experiments
Evidence experimental; Illumina [1], qPCR [1]
Database links
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).