Stem-loop sequence hsa-mir-5089

AccessionMI0017978 (change log)
Symbol HGNC:MIR5089
DescriptionHomo sapiens miR-5089 stem-loop
Stem-loop
   --                                  g  auc 
5'   aaggacuucagugggauuucugaguagcauccuu ga   u
     |||||||||||||||||||||||||||||||||| ||    
3'   uuccugaagucacccuaaaggcucaucguaggga cu   g
   uu                                  a  cac 
Get sequence
Deep sequencing
75 reads, 34.4 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 46973017-46973100 [+]
sense
OTTHUMT00000360947 ; ATP5G1-002; exon 3
OTTHUMT00000361089 ; ATP5G1-011; exon 3
OTTHUMT00000361090 ; ATP5G1-012; exon 3
OTTHUMT00000361086 ; ATP5G1-008; 3'UTR (exon 4)
OTTHUMT00000361087 ; ATP5G1-009; exon 4
OTTHUMT00000360946 ; ATP5G1-001; 3'UTR (exon 5)
OTTHUMT00000361084 ; ATP5G1-006; 3'UTR (exon 5)
OTTHUMT00000360948 ; ATP5G1-003; 3'UTR (exon 5)
ENST00000513347 ; ATP5G1-002; exon 3
ENST00000502964 ; ATP5G1-011; exon 3
ENST00000515060 ; ATP5G1-012; exon 3
ENST00000506855 ; ATP5G1-008; 3'UTR (exon 4)
ENST00000513781 ; ATP5G1-009; exon 4
ENST00000355938 ; ATP5G1-001; 3'UTR (exon 5)
ENST00000503641 ; ATP5G1-006; 3'UTR (exon 5)
ENST00000393366 ; ATP5G1-003; 3'UTR (exon 5)
antisense
OTTHUMT00000361072 ; RP11-463M16.4-002; intron 1
ENST00000508743 ; SUMO2P17-002; intron 1
Database links

Mature sequence hsa-miR-5089-5p

Accession MIMAT0021081
Previous IDshsa-miR-5089
Sequence

11 - 

gugggauuucugaguagcauc

 - 31

Get sequence
Deep sequencing46 reads, 21 experiments
Evidence experimental; Illumina [1-2], qPCR [1]
Predicted targets

Mature sequence hsa-miR-5089-3p

Accession MIMAT0022984
Sequence

53 - 

augcuacucggaaaucccacuga

 - 75

Get sequence
Deep sequencing25 reads, 11 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).