Stem-loop sequence hsa-mir-5088

AccessionMI0017977 (change log)
Symbol HGNC:MIR5088
DescriptionHomo sapiens miR-5088 stem-loop
Stem-loop
   cccauc            uu   u     u a     g agg 
5'       agggcucaggga  gga ggagg g ugggg c   g
         ||||||||||||  ||| ||||| | ||||| |    
3'       ucccggguccuu  cuu ccucc c acucu g   g
   ---gac            --   c     - -     g gua 
Get sequence
Deep sequencing
141 reads, 0 reads per million, 51 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 49682117-49682195 [+]
sense
OTTHUMT00000465657 ; TRPM4-011; intron 4
OTTHUMT00000465634 ; TRPM4-004; intron 5
OTTHUMT00000465632 ; TRPM4-003; intron 7
OTTHUMT00000465633 ; TRPM4-005; intron 8
OTTHUMT00000465543 ; TRPM4-001; intron 9
OTTHUMT00000465654 ; TRPM4-006; intron 9
OTTHUMT00000465655 ; TRPM4-007; intron 9
ENST00000601347 ; TRPM4-011; intron 4
ENST00000598697 ; TRPM4-004; intron 5
ENST00000355712 ; TRPM4-201; intron 5
ENST00000595519 ; TRPM4-003; intron 7
ENST00000598502 ; TRPM4-005; intron 8
ENST00000252826 ; TRPM4-001; intron 9
ENST00000427978 ; TRPM4-006; intron 9
ENST00000596338 ; TRPM4-007; intron 9
Database links

Mature sequence hsa-miR-5088-5p

Accession MIMAT0021080
Sequence

6 - 

cagggcucagggauuggauggagg

 - 29

Get sequence
Deep sequencing114 reads, 37 experiments
Evidence experimental; Illumina [1], qPCR [1], meta-analysis [2]
Predicted targets

Mature sequence hsa-miR-5088-3p

Accession MIMAT0027041
Sequence

58 - 

ucccuucuuccugggcccuca

 - 78

Get sequence
Deep sequencing19 reads, 11 experiments
Evidence experimental; meta-analysis [2]
Database links
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).
2
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).