Stem-loop sequence hsa-mir-5087

AccessionMI0017976 (change log)
Symbol HGNC:MIR5087
DescriptionHomo sapiens miR-5087 stem-loop
Literature search

1 open access papers mention hsa-mir-5087
(1 sentences)

Stem-loop
   a       a ggg     a    u  u   a   uaagu 
5'  gcuuucu c   uuugu gcuu gc ggc ugu     g
    ||||||| |   ||||| |||| || ||| |||     u
3'  ugaaaga g   gaaua cgaa cg cug aca     u
   a       - aaa     -    -  -   -   uccug 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 148334479-148334554 [-]
sense
OTTHUMT00000100690 ; NBPF20-002; intron 10
OTTHUMT00000100689 ; NBPF20-001; intron 11
OTTHUMT00000171065 ; NBPF20-003; intron 11
ENST00000369189 ; NBPF20-002; intron 10
ENST00000369202 ; NBPF20-001; intron 11
ENST00000369188 ; NBPF20-003; intron 11
Database links

Mature sequence hsa-miR-5087

Accession MIMAT0021079
Sequence

11 - 

ggguuuguagcuuugcuggcaug

 - 33

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1], qPCR [1]
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).