Stem-loop sequence hsa-mir-5047

AccessionMI0017932 (change log)
Symbol HGNC:MIR5047
DescriptionHomo sapiens miR-5047 stem-loop
Stem-loop
   gaa  ---g      u    ---ga   -a   -    ua      -   uuug g 
5'    gc    cuugcc agac     gac  cag ugca  aaaaca acu    g g
      ||    |||||| ||||     |||  ||| ||||  |||||| |||    |  
3'    cg    gaacgg ucug     uug  guc acgu  uuuugu ugg    c g
   --a  aaca      u    gaaug   gc   g    uc      a   ---a a 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 64501214-64501313 [-]
antisense
OTTHUMT00000446950 ; PRKCA-001; intron 3
OTTHUMT00000446976 ; PRKCA-002; intron 3
OTTHUMT00000446977 ; PRKCA-003; intron 3
ENST00000578063 ; PRKCA-001; intron 3
ENST00000413366 ; PRKCA-002; intron 3
ENST00000284384 ; PRKCA-003; intron 3
Clustered miRNAs
< 10kb from hsa-mir-5047
hsa-mir-5047chr17: 64501214-64501313 [-]
hsa-mir-3064chr17: 64500774-64500839 [-]
Database links

Mature sequence hsa-miR-5047

Accession MIMAT0020541
Sequence

64 - 

uugcagcugcgguuguaaggu

 - 84

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Northern [1], RTPCR [1]
Predicted targets

References

1
PMID:21346006 "An evolutionarily conserved, alternatively spliced, intron in the p68/DDX5 DEAD-box RNA helicase gene encodes a novel miRNA" Moore HC, Johnston M, Nicol SM, Bourdon JC, Thompson AM, Hutvagner G, Fuller-Pace FV RNA. 17:555-562(2011).