Stem-loop sequence hsa-mir-5011

AccessionMI0017879 (change log)
Symbol HGNC:MIR5011
DescriptionHomo sapiens miR-5011 stem-loop
Stem-loop
   --a  u  uau          c                       c    gu 
5'    ga gg   ugaguggaug uguuauauauacagccaugcacu ugua  u
      || ||   |||||||||| ||||||||||||||||||||||| ||||  u
3'    cu uc   acuuaccuau acaauauauaugucgguacguga acau  g
   cga  u  --u          c                       c    gg 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 67081584-67081686 [+]
sense
OTTHUMT00000442969 ; DOK6-001; intron 1
ENST00000382713 ; DOK6-001; intron 1
Database links

Mature sequence hsa-miR-5011-5p

Accession MIMAT0021045
Sequence

24 - 

uauauauacagccaugcacuc

 - 44

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5011-3p

Accession MIMAT0021046
Sequence

62 - 

gugcauggcuguauauauaaca

 - 83

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).