Stem-loop sequence hsa-mir-5010

AccessionMI0017878 (change log)
Symbol HGNC:MIR5010
DescriptionHomo sapiens miR-5010 stem-loop
Literature search

4 open access papers mention hsa-mir-5010
(5 sentences)

Stem-loop
   gauc     a   c    --  --a         c   -          uggccuacagcugc 
5'     caggg acc uaga  gc   gggggaugg aga gcaaaauuca              c
       ||||| ||| ||||  ||   ||||||||| ||| ||||||||||              u
3'     guuuc ugg gucu  cg   ccccuuacc ucu uguuuuaggu              c
   ----     g   a    gu  aga         c   g          cacgucaaaccguu 
Get sequence
Deep sequencing
2222 reads, 1.36 reads per million, 147 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 42514188-42514307 [+]
antisense
OTTHUMT00000457796 ; GPATCH8-003; intron 2
OTTHUMT00000457799 ; GPATCH8-010; intron 2
OTTHUMT00000457801 ; GPATCH8-007; intron 2
OTTHUMT00000457797 ; GPATCH8-001; intron 3
OTTHUMT00000457798 ; GPATCH8-002; intron 4
OTTHUMT00000457800 ; GPATCH8-006; intron 5
OTTHUMT00000457802 ; GPATCH8-008; intron 5
OTTHUMT00000457803 ; GPATCH8-009; intron 5
ENST00000335500 ; GPATCH8-003; intron 2
ENST00000585614 ; GPATCH8-010; intron 2
ENST00000586265 ; GPATCH8-007; intron 2
ENST00000591680 ; GPATCH8-001; intron 3
ENST00000587228 ; GPATCH8-002; intron 4
ENST00000434000 ; GPATCH8-201; intron 4
ENST00000590041 ; GPATCH8-006; intron 5
ENST00000592746 ; GPATCH8-008; intron 5
ENST00000586037 ; GPATCH8-009; intron 5
Database links

Mature sequence hsa-miR-5010-5p

Accession MIMAT0021043
Sequence

21 - 

agggggauggcagagcaaaauu

 - 42

Get sequence
Deep sequencing1004 reads, 79 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-5010-3p

Accession MIMAT0021044
Sequence

80 - 

uuuugugucucccauuccccag

 - 101

Get sequence
Deep sequencing1207 reads, 132 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
2
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).