Stem-loop sequence hsa-mir-5008

AccessionMI0017876 (change log)
Symbol HGNC:MIR5008
DescriptionHomo sapiens miR-5008 stem-loop
Literature search

1 open access papers mention hsa-mir-5008
(2 sentences)

Stem-loop
            c u    u             u         u  ugc 
5' gggcugacc c aggg caggugaggcccu ggggcacag gg   c
   ||||||||| | |||| ||||||||||||| ||||||||| ||    
3' cccggcugg g uccc guccgcuccggga ccucguguc cc   a
            a u    u             c         c  ucu 
Get sequence
Deep sequencing
175 reads, 1.56 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 227941590-227941683 [-]
antisense
OTTHUMT00000091962 ; SNAP47-002; intron 1
OTTHUMT00000091964 ; SNAP47-004; intron 1
OTTHUMT00000470225 ; SNAP47-011; intron 1
OTTHUMT00000091969 ; SNAP47-009; intron 1
OTTHUMT00000091967 ; SNAP47-007; intron 2
OTTHUMT00000091961 ; SNAP47-001; intron 2
OTTHUMT00000091963 ; SNAP47-003; intron 2
ENST00000366760 ; SNAP47-002; intron 1
ENST00000418653 ; SNAP47-004; intron 1
ENST00000606873 ; SNAP47-011; intron 1
ENST00000478768 ; SNAP47-009; intron 1
ENST00000491439 ; SNAP47-007; intron 2
ENST00000366759 ; SNAP47-001; intron 2
ENST00000426344 ; SNAP47-003; intron 2
ENST00000315781 ; SNAP47-201; intron 2
Database links

Mature sequence hsa-miR-5008-5p

Accession MIMAT0021039
Sequence

22 - 

ugaggcccuuggggcacagugg

 - 43

Get sequence
Deep sequencing100 reads, 36 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5008-3p

Accession MIMAT0021040
Sequence

54 - 

ccugugcucccagggccucgc

 - 74

Get sequence
Deep sequencing32 reads, 24 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).