Stem-loop sequence hsa-mir-5007

AccessionMI0017874 (change log)
Symbol HGNC:MIR5007
DescriptionHomo sapiens miR-5007 stem-loop
Literature search

2 open access papers mention hsa-mir-5007
(2 sentences)

Stem-loop
   gguaaaccuugg              c   c g          a a 
5'             ugacuaauuagagu ugg u auaugguuug c c
               |||||||||||||| ||| | |||||||||| | a
3'             acugauuaaucuca acc a uauacuaaau g g
   uugucuuuaaua              a   a g          c a 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 55174454-55174548 [+]
intergenic
Database links

Mature sequence hsa-miR-5007-5p

Accession MIMAT0021035
Sequence

21 - 

uagagucuggcugauaugguuu

 - 42

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5007-3p

Accession MIMAT0021036
Sequence

56 - 

aucauaugaaccaaacucuaau

 - 77

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).